KAN11563, KAN11563 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN11563
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(ATGT)5
Primer 1KAN11563.forward primer: GGATCGCATGTATGCTTCCT
Primer 2KAN11563.reverse primer: ACCAGCCTCTCAGTGTTGCT
Max Length282
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr05supercontigVcev1_p0.Chr05:250396..250632 .