KAN07889, KAN07889 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN07889
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(GA)6
Primer 1KAN07889.forward primer: ATGCCTTTTCTCCCTGTCCT
Primer 2KAN07889.reverse primer: GGAGGCCTTTGTTGATGCTA
Max Length295
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr02supercontigVcev1_p0.Chr02:33096186..33096462 .