KAN11695, KAN11695 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11695
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(AG)8
Primer 1	KAN11695.forward primer: GCGCTTGACCAGGAAAAGTA
Primer 2	KAN11695.reverse primer: GGCATTGGTGAAGGAAGAGA
Max Length	312
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr02	supercontig	Vcev1_p0.Chr02:53921299..53921552 .
scaffold00332	supercontig	scaffold00332:172738..172987 .
chr2_H1	supercontig	chr2_H1:46965254..46965521 .

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.