KAN11200, KAN11200 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11200
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11200.forward primer: CGTGCCCTGAAAAAGGAGTA
Primer 2	KAN11200.reverse primer: GGTTGTGCGTTTGGAGAAAT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr02	supercontig	Vcev1_p0.Chr02:59556822..59556950 .
VaccDscaff3	supercontig	VaccDscaff3:2588729..2588865 .
scaffold00359	supercontig	scaffold00359:114345..114750 .
Chr02	supercontig	Chr02:41920649..41920775 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG2	N/A	86	KAN-11200_133	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG01	N/A	12.6	KAN-11200	View
3	Blueberry-F1#10-2017	LG01	N/A	14.6	KAN-11200	View