KAN11325, KAN11325 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN11325
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1KAN11325.forward primer: CAACATTCCCGAAAACCAGT
Primer 2KAN11325.reverse primer: ACCCTTCACCTGACACCATC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-F1LG08N/A0KAN-11325_188View
2Blueberry-F1#10xW85-23-F1LG4N/A156KAN-11325_188View
3Cranberry-Composite_map-F1LG08N/A2.38KAN-11325_188View
4Cranberry-Mullica_Queen_1-F1LG08N/A2.38KAN-11325_188View
5Blueberry-F1#10_x_W85-23-F1-2017LG08N/A87.4KAN-11325View
6Cranberry-Crimson_Queen-2017LG08N/A70.2KAN-11325View
7Cranberry-Mullica_Queen-2017LG08N/A98.9KAN-11325View
8Blueberry-F1#10-2017LG08N/A87.3KAN-11325View
9Cranberry-CNJ02-1-2017LG08N/A85.7KAN-11325View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerKAN11325.forward primerVaccinium corymbosumprimer
reverse primerKAN11325.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
KAN-11325_188KAN-11325_188Vaccinium corymbosummarker_locus
KAN-11325_188KAN-11325_188-2.38Vaccinium corymbosummarker_locus
KAN-11325KAN-11325Vaccinium corymbosummarker_locus