KAN11325, KAN11325 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11325
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11325.forward primer: CAACATTCCCGAAAACCAGT
Primer 2	KAN11325.reverse primer: ACCCTTCACCTGACACCATC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr10	supercontig	Vcev1_p0.Chr10:4850423..4850586 .
chr10_H1	supercontig	chr10_H1:3657131..3657287 .
Chr10	supercontig	Chr10:31681457..31681644 .
Chr10_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr10_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:36590364..36590519 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG4	N/A	156	KAN-11325_188	View
2	Cranberry-Crimson_Queen-F1	LG08	N/A	0	KAN-11325_188	View
3	Cranberry-Composite_map-F1	LG08	N/A	2.38	KAN-11325_188	View
4	Cranberry-Mullica_Queen_1-F1	LG08	N/A	2.38	KAN-11325_188	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG08	N/A	87.4	KAN-11325	View
6	Blueberry-F1#10-2017	LG08	N/A	87.3	KAN-11325	View
7	Cranberry-CNJ02-1-2017	LG08	N/A	85.7	KAN-11325	View
8	Cranberry-Crimson_Queen-2017	LG08	N/A	70.2	KAN-11325	View
9	Cranberry-Mullica_Queen-2017	LG08	N/A	98.9	KAN-11325	View