KAN11440, KAN11440 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11440
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11440.forward primer: CCAGTAACAATGAGCTGCCA
Primer 2	KAN11440.reverse primer: GATCGTTGCTGAAGGGTTGT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr08	supercontig	Vcev1_p0.Chr08:24335567..24335844 .
scaffold00866	supercontig	scaffold00866:41990..42265 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	77	KAN-11440_291	View
2	Cranberry-Composite_map-F1	LG03	N/A	35.34	KAN-11440_291	View
3	Cranberry-Crimson_Queen-F1	LG03	N/A	36.56	KAN-11440_291	View
4	Cranberry-Mullica_Queen_1-F1	LG03	N/A	47.14	KAN-11440_291	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG03	N/A	45	KAN-11440	View
6	Blueberry-F1#10-2017	LG03	N/A	44.9	KAN-11440	View
7	Blueberry-W85-23-2017	LG03	N/A	45.2	KAN-11440	View
8	Cranberry-CNJ02-1-2017	LG03	N/A	55.5	KAN-11440	View
9	Cranberry-Crimson_Queen-2017	LG03	N/A	50.8	KAN-11440	View
10	Cranberry-Mullica_Queen-2017	LG03	N/A	60.4	KAN-11440	View