KAN12137, KAN12137 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN12137
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(CT)11
Primer 1	KAN12137.forward primer: GTTGCCTTGGCAAACTGACT
Primer 2	KAN12137.reverse primer: ACCCCCATGATTGAGATTGA
Max Length	309
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4_H1	supercontig	chr4_H1:3922896..3923193 .

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.