KAN12477, KAN12477 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN12477
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Repeat Motif	(TC)10
Primer 1	KAN12477.forward primer: CTTGCGAGGATGAAGACCTC
Primer 2	KAN12477.reverse primer: GTTCGCTAACCGTCACCATT
Max Length	276
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff1	supercontig	VaccDscaff1:24872569..24872819 .
scaffold00548	supercontig	scaffold00548:175611..175868 .
chr1_H1	supercontig	chr1_H1:30322223..30322473 .
Chr01	supercontig	Chr01:18159068..18159316 .

Publications


Year	Publication
2014	Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689.