KAN11529, KAN11529 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN11529
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AT)6
Primer 1KAN11529.forward primer: CCCTGGTTCTTGTGGTTCTT
Primer 2KAN11529.reverse primer: GGGCGGCTCGAATATGTTA
Max Length282
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr04supercontigVcev1_p0.Chr04:8025890..8026124 .