KAN11529, KAN11529 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN11529
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AT)6
Primer 1KAN11529.forward primer: CCCTGGTTCTTGTGGTTCTT
Primer 2KAN11529.reverse primer: GGGCGGCTCGAATATGTTA
Max Length282
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerKAN11529.forward primerVaccinium corymbosumprimer
reverse primerKAN11529.reverse primerVaccinium corymbosumprimer