NA1040, NA1040 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameNA1040
Genbank IDCF811165
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TC)11
Primer 1NA1040.forward primer: GCAACTCCCAGACTTTCTCC
Primer 2NA1040.reverse primer: GTTTAGTCAGCAGGGTGCACAA
Max Length180
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A88.5NA1040ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankCF811165
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNA1040.forward primerVaccinium corymbosumprimer
reverse primerNA1040.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NA1040NA1040Vaccinium corymbosummarker_locus