|
Marker Overview
Name | NA1040 |
Genbank ID | CF811165 |
Type | SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (TC)11 |
Primer 1 | NA1040.forward primer: GCAACTCCCAGACTTTCTCC |
Primer 2 | NA1040.reverse primer: GTTTAGTCAGCAGGGTGCACAA |
Max Length | 180 |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | CF811165 |
Alignments
The following features are aligned
Publications
Year | Publication |
2013 | Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92. |
2006 | Boches P, Bassil N, Rowland L. Genetic Diversity in the Highbush Blueberry Evaluated with Microsatellite Markers. Journal of the American Society for Horticultural Science. 2006; 131(5):674-686. |
2005 | Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660. |
|