SIZ1-2, SIZ1-2 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameSIZ1-2
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1SIZ1-2.forward primer: ATTGCAATCTTGCACAGAGAGA
Primer 2SIZ1-2.reverse primer: CTACATAGGATACGCATTGGCA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10xW85-23-F1LG1N/A50SIZ1-2_83View
2Blueberry-F1#10xW85-23-F1LG1N/A50SIZ1-2_87View
3Cranberry-Composite_map-F1LG09N/A87.09SIZ1-2_87bView
4Cranberry-Mullica_Queen_1-F1LG09N/A100.16SIZ1-2_87bView
5Blueberry-F1#10-2017LG09N/A3.6SIZ1-2View
6Blueberry-F1#10_x_W85-23-F1-2017LG09N/A2.4SIZ1-2View
7Cranberry-Mullica_Queen-2017LG09N/A2.3SIZ1-2View
8Cranberry-CNJ02-1-2017LG09N/A2.7SIZ1-2View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSIZ1-2.forward primerVaccinium corymbosumprimer
reverse primerSIZ1-2.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SIZ1-2_83SIZ1-2_83Vaccinium corymbosummarker_locus
SIZ1-2_87SIZ1-2_87Vaccinium corymbosummarker_locus
SIZ1-2_87bSIZ1-2_87b-87.09Vaccinium corymbosummarker_locus
SIZ1-2_87bSIZ1-2_87b-100.16Vaccinium corymbosummarker_locus
SIZ1-2SIZ1-2Vaccinium corymbosummarker_locus