SIZ1-2, SIZ1-2 (genetic_marker) Vaccinium corymbosum

Name	SIZ1-2
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	SIZ1-2.forward primer: ATTGCAATCTTGCACAGAGAGA
Primer 2	SIZ1-2.reverse primer: CTACATAGGATACGCATTGGCA
Publication	[view all]

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	50	SIZ1-2_83	View
2	Blueberry-F1#10xW85-23-F1	LG1	N/A	50	SIZ1-2_87	View
3	Cranberry-Composite_map-F1	LG09	N/A	87.09	SIZ1-2_87b	View
4	Cranberry-Mullica_Queen_1-F1	LG09	N/A	100.16	SIZ1-2_87b	View
5	Blueberry-F1#10-2017	LG09	N/A	3.6	SIZ1-2	View
6	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	2.4	SIZ1-2	View
7	Cranberry-Mullica_Queen-2017	LG09	N/A	2.3	SIZ1-2	View
8	Cranberry-CNJ02-1-2017	LG09	N/A	2.7	SIZ1-2	View

Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
forward primer	SIZ1-2.forward primer	Vaccinium corymbosum	primer
reverse primer	SIZ1-2.reverse primer	Vaccinium corymbosum	primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
SIZ1-2_83	SIZ1-2_83	Vaccinium corymbosum	marker_locus
SIZ1-2_87	SIZ1-2_87	Vaccinium corymbosum	marker_locus
SIZ1-2_87b	SIZ1-2_87b-87.09	Vaccinium corymbosum	marker_locus
SIZ1-2_87b	SIZ1-2_87b-100.16	Vaccinium corymbosum	marker_locus
SIZ1-2	SIZ1-2	Vaccinium corymbosum	marker_locus