SIZ1-2, SIZ1-2 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	SIZ1-2
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	SIZ1-2.forward primer: ATTGCAATCTTGCACAGAGAGA
Primer 2	SIZ1-2.reverse primer: CTACATAGGATACGCATTGGCA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00717	supercontig	scaffold00717:86547..86825 .
Vmac_chr09	supercontig	Vmac_chr09:11098327..11098439 .
chr9	supercontig	chr9:30489501..30489605 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	50	SIZ1-2_83	View
2	Blueberry-F1#10xW85-23-F1	LG1	N/A	50	SIZ1-2_87	View
3	Cranberry-Composite_map-F1	LG09	N/A	87.09	SIZ1-2_87b	View
4	Cranberry-Mullica_Queen_1-F1	LG09	N/A	100.16	SIZ1-2_87b	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	2.4	SIZ1-2	View
6	Blueberry-F1#10-2017	LG09	N/A	3.6	SIZ1-2	View
7	Cranberry-CNJ02-1-2017	LG09	N/A	2.7	SIZ1-2	View
8	Cranberry-Mullica_Queen-2017	LG09	N/A	2.3	SIZ1-2	View