Pr031818814, Pr031818814 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818814
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818814.forward primer: CTCACCCATCCTTCTCCTCT
Primer 2	Pr031818814.reverse primer: CGGTGTTGATGTCATGCTT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr06	supercontig	Vcev1_p0.Chr06:41073141..41073325 .
Chr06_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr06_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:11903255..11903436 .
Chr06_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr06_Vaccinium_vitis-idaea_ssp_minus:11450502..11450674 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	122	Pr031818814	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG09	N/A	26.3	Pr031818814	View
3	Blueberry-F1#10-2017	LG09	N/A	60.7	Pr031818814	View
4	Cranberry-CNJ02-1-2017	LG09	N/A	53.2	Pr031818814	View
5	Cranberry-Crimson_Queen-2017	LG09	N/A	46.4	Pr031818814	View
6	Cranberry-Mullica_Queen-2017	LG09	N/A	61.2	Pr031818814	View
7	Cranberry-Composite_map-F1	LG09	N/A	32.8	Pr031818814	View
8	Cranberry-Crimson_Queen-F1	LG09	N/A	23.89	Pr031818814	View
9	Cranberry-Mullica_Queen_1-F1	LG09	N/A	38.18	Pr031818814	View