VCC_J5, VCC_J5 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameVCC_J5
Genbank IDAY762682
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TC)17
Primer 1VCC_J5.forward primer: CCCCAACGGTCTTGATCTTA
Primer 2VCC_J5.reverse primer: GTTTCCTCTCTCTCCAACCCCAGT
Max Length250
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG5N/A55.8VCC_J5View
2Cranberry-BB/CQ-F1LG05N/A37.64VCC_J5View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY762682
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerVCC_J5.forward primerVaccinium corymbosumprimer
reverse primerVCC_J5.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VCC_J5VCC_J5Vaccinium corymbosummarker_locus
VCC_J5VCC_J5-37.642Vaccinium corymbosummarker_locus