VCC_J9, VCC_J9 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameVCC_J9
Genbank IDAY762683
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TG)9(GA)23
Primer 1VCC_J9.forward primer: GCGAAGAACTTCCGTCAAAA
Primer 2VCC_J9.reverse primer: GTGAGGGCACAAAGCTCTC
Max Length100
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A13.8VCC_J9View
2Cranberry-Crimson_Queen-2007LG9N/A26.3VCC_J9View
3Cranberry-Mullica_Queen-2007LG9N/A21.1VCC_J9View
4Cranberry-Crimson_Queen-2017LG09N/A12.4VCC_J9View
5Cranberry-CNJ02-1-2007LG9N/A23.36VCC_J9View
6Cranberry-Unifiedmap2013LG1N/A81.6VCC_J9View
7Cranberry-CNJ02-1-2017LG09N/A13.2VCC_J9View
8Blueberry-DraperLG11N/A25VCC-j9aView
9Blueberry-DraperLG11N/A33VCC-j9bView
10Blueberry-JewelLG11aN/A23VCC_J9cView
11Cranberry-Composite_map-F1LG09N/A75.26VCC_J9View
12Cranberry-Crimson_Queen-F1LG09N/A51.29VCC_J9View
13Cranberry-Mullica_Queen_1-F1LG09N/A87.05VCC_J9View
14Cranberry-BB/CQ-F1LG01N/A73.42VCC_J9View
15Cranberry-BB/CQ-F1LG01N/A71.47VCC_J9View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY762683
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerVCC_J9.forward primerVaccinium corymbosumprimer
reverse primerVCC_J9.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VCC_J9VCC_J9Vaccinium corymbosummarker_locus
VCC-j9aVCC-j9aVaccinium corymbosummarker_locus
VCC-j9bVCC-j9bVaccinium corymbosummarker_locus
VCC_J9cVCC_J9cVaccinium corymbosummarker_locus
VCC_J9VCC_J9-75.26Vaccinium corymbosummarker_locus
VCC_J9VCC_J9-51.29Vaccinium corymbosummarker_locus
VCC_J9VCC_J9-87.05Vaccinium corymbosummarker_locus
VCC_J9VCC_J9-73.417Vaccinium corymbosummarker_locus
VCC_J9VCC_J9-71.469Vaccinium corymbosummarker_locus