1trimcontig176042, 1trimcontig176042 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig176042
Genbank IDKP279221
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AGA)13
Primer 11trimcontig176042.forward primer: CCGTTGTTGTTCTTCTGTAGT
Primer 21trimcontig176042.reverse primer: TTCAACCTCTGAAGCCTCT
Max Length234
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-F1LG11N/A01trimcontig176042View
2Cranberry-CNJ02-1-2017LG11N/A3.21trimcontig176042View
3Cranberry-Crimson_Queen-2017LG11N/A01trimcontig176042View
4Cranberry-CNJ02-1-2007LG11N/A1.651trimcontig176042View
5Blueberry-F1#10_x_W85-23-F1-2017LG11N/A01trimcontig176042View
6Blueberry-F1#10-2017LG11N/A01trimcontig176042View
7Cranberry-Crimson_Queen-2007LG11N/A0.71tc176042View
8Cranberry-Composite_map-F1LG11N/A4.391trimcontig176042View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279221
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig176042.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig176042.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig1760421trimcontig176042Vaccinium macrocarponmarker_locus
1tc1760421tc176042Vaccinium macrocarponmarker_locus
1trimcontig1760421trimcontig176042-4.39Vaccinium macrocarponmarker_locus