1trimcontig178358, 1trimcontig178358 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig178358
Genbank IDKP279224
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 11trimcontig178358.forward primer: AATTGAACGATCCCTATTCC
Primer 21trimcontig178358.reverse primer: GATTCATCACCCCTTGAAC
Max Length249
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Composite_map-F1LG02N/A1.791trimcontig178358ViewN/A
2Cranberry-Mullica_Queen-2017LG02N/A107.81trimcontig178358ViewN/A
3Cranberry-CNJ02-1-2017LG02N/A99.91trimcontig178358ViewN/A
4Cranberry-Crimson_Queen-F1LG02N/A1.791trimcontig178358ViewN/A
5Cranberry-Mullica_Queen_1-F1LG02N/A0.61trimcontig178358ViewN/A
6Cranberry-Crimson_Queen-2017LG02N/A92.31trimcontig178358ViewN/A
7Cranberry-Mullica_Queen_2-F1LG02N/A01trimcontig178358ViewN/A
8Cranberry-Stevens-F1LG02N/A2.991trimcontig178358ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279224
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig178358.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig178358.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig1783581trimcontig178358-1.79Vaccinium macrocarponmarker_locus
1trimcontig1783581trimcontig178358-0.6Vaccinium macrocarponmarker_locus
1trimcontig1783581trimcontig178358Vaccinium macrocarponmarker_locus
1trimcontig1783581trimcontig178358-2.99Vaccinium macrocarponmarker_locus