1trimcontig182430, 1trimcontig182430 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig182430
Genbank IDKP279226
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)14
Primer 11trimcontig182430.forward primer: GAAGATGGACCTGAGTAAGAAA
Primer 21trimcontig182430.reverse primer: CTACCATTGTGTTCTCAAACTG
Max Length194
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279226
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A17.81trimcontig182430View
2Cranberry-CNJ02-1-2017LG01N/A14.11trimcontig182430View
3Cranberry-Mullica_Queen-2017LG01N/A15.21trimcontig182430View
4Cranberry-Mullica_Queen-2007LG1N/A19.91tc182430View
5Cranberry-Composite_map-F1LG01N/A100.351trimcontig182430View
6Cranberry-Mullica_Queen_1-F1LG01N/A86.11trimcontig182430View