1trimcontig182430, 1trimcontig182430 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig182430
Genbank IDKP279226
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)14
Primer 11trimcontig182430.forward primer: GAAGATGGACCTGAGTAAGAAA
Primer 21trimcontig182430.reverse primer: CTACCATTGTGTTCTCAAACTG
Max Length194
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2017LG01N/A15.21trimcontig182430ViewN/A
2Cranberry-CNJ02-1-2007LG1N/A17.81trimcontig182430ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A14.11trimcontig182430ViewN/A
4Cranberry-Mullica_Queen-2007LG1N/A19.91tc182430ViewN/A
5Cranberry-Composite_map-F1LG01N/A100.351trimcontig182430ViewN/A
6Cranberry-Mullica_Queen_1-F1LG01N/A86.11trimcontig182430ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279226
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig182430.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig182430.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig1824301trimcontig182430Vaccinium macrocarponmarker_locus
1tc1824301tc182430Vaccinium macrocarponmarker_locus
1trimcontig1824301trimcontig182430-100.35Vaccinium macrocarponmarker_locus
1trimcontig1824301trimcontig182430-86.1Vaccinium macrocarponmarker_locus