1trimcontig238343, 1trimcontig238343 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig238343
Genbank IDKP279232
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)15
Primer 11trimcontig238343.forward primer: GGTAATAGCTTTGTGATCTTGC
Primer 21trimcontig238343.reverse primer: GATGGTGAATAAATTGCGAC
Max Length329
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG09N/A54.21trimcontig238343View
2Cranberry-CNJ02-1-2007LG9N/A73.061trimcontig238343View
3Cranberry-CNJ02-1-2017LG09N/A64.81trimcontig238343View
4Cranberry-Mullica_Queen-2017LG09N/A77.61trimcontig238343View
5Cranberry-Mullica_Queen-2007LG9N/A881tc238343View
6Cranberry-Crimson_Queen-2007LG9N/A66.11tc238343View
7Cranberry-Composite_map-F1LG09N/A21.731trimcontig238343View
8Cranberry-Crimson_Queen-F1LG09N/A16.161trimcontig238343View
9Cranberry-Mullica_Queen_1-F1LG09N/A24.491trimcontig238343View
10Cranberry-Mullica_Queen_2-F1LG09N/A31.141trimcontig238343View
11Cranberry-Stevens-F1LG09N/A9.051trimcontig238343View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279232
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig238343.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig238343.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig2383431trimcontig238343Vaccinium macrocarponmarker_locus
1tc2383431tc238343Vaccinium macrocarponmarker_locus
1trimcontig2383431trimcontig238343-21.73Vaccinium macrocarponmarker_locus
1trimcontig2383431trimcontig238343-16.16Vaccinium macrocarponmarker_locus
1trimcontig2383431trimcontig238343-24.49Vaccinium macrocarponmarker_locus
1trimcontig2383431trimcontig238343-31.14Vaccinium macrocarponmarker_locus
1trimcontig2383431trimcontig238343-9.05Vaccinium macrocarponmarker_locus