1trimcontig238795, 1trimcontig238795 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig238795
Genbank IDKP279233
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)14
Primer 11trimcontig238795.forward primer: AGAGGGAGAGAAGAGTATGGTC
Primer 21trimcontig238795.reverse primer: CCGTCAAGATTTGTGAAGAT
Max Length287
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279233
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
chr1supercontigchr1:11801545..11801808 .Vaccinium macrocarpon cv. Stevens v1.0 genome sequenceGDV marker alignment to genome using primer sequences
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A36.851trimcontig238795View
2Cranberry-CNJ02-1-2017LG01N/A34.81trimcontig238795View
3Cranberry-Crimson_Queen-2017LG01N/A31.41trimcontig238795View
4Cranberry-Crimson_Queen-2007LG1N/A32.21tc238795View
5Cranberry-Composite_map-F1LG01N/A77.271trimcontig238795View
6Cranberry-Crimson_Queen-F1LG01N/A50.061trimcontig238795View