1trimcontig238795, 1trimcontig238795 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig238795
Genbank IDKP279233
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)14
Primer 11trimcontig238795.forward primer: AGAGGGAGAGAAGAGTATGGTC
Primer 21trimcontig238795.reverse primer: CCGTCAAGATTTGTGAAGAT
Max Length287
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A34.81trimcontig238795ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A31.41trimcontig238795ViewN/A
3Cranberry-CNJ02-1-2007LG1N/A36.851trimcontig238795ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A32.21tc238795ViewN/A
5Cranberry-Composite_map-F1LG01N/A77.271trimcontig238795ViewN/A
6Cranberry-Crimson_Queen-F1LG01N/A50.061trimcontig238795ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279233
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig238795.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig238795.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig2387951trimcontig238795Vaccinium macrocarponmarker_locus
1tc2387951tc238795Vaccinium macrocarponmarker_locus
1trimcontig2387951trimcontig238795-77.27Vaccinium macrocarponmarker_locus
1trimcontig2387951trimcontig238795-50.06Vaccinium macrocarponmarker_locus