29080_K63, 29080_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name29080_K63
Genbank IDKP279160
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 129080_K63.forward primer: ATGAAAACAGGGTAAACTGG
Primer 229080_K63.reverse primer: TCTCAACTCATAGAACTACGGA
Max Length399
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG2N/A71.3929080_K63View
2Cranberry-Crimson_Queen-2017LG02N/A64.529080_K63View
3Cranberry-CNJ02-1-2017LG02N/A73.129080_K63View
4Cranberry-Crimson_Queen-2007LG2N/A6429080_K63View
5Cranberry-Composite_map-F1LG02N/A23.9229080_K63View
6Cranberry-Crimson_Queen-F1LG02N/A34.5729080_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279160
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer29080_K63.forward primerVaccinium macrocarponprimer
reverse primer29080_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
29080_K6329080_K63Vaccinium macrocarponmarker_locus
29080_K6329080_K63-23.92Vaccinium macrocarponmarker_locus
29080_K6329080_K63-34.57Vaccinium macrocarponmarker_locus