1trimcontig440230, 1trimcontig440230 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig440230
Genbank IDKP279249
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AGA)12
Primer 11trimcontig440230.forward primer: ACACTTTGTAGGTGGTGGTTAT
Primer 21trimcontig440230.reverse primer: ATTAGCAGTAGTCCAATCGGT
Max Length243
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Blueberry-F1#10-2017LG01N/A59.91trimcontig440230ViewN/A
2Blueberry-F1#10_x_W85-23-F1-2017LG01N/A49.61trimcontig440230ViewN/A
3Cranberry-Mullica_Queen-2017LG01N/A53.41trimcontig440230ViewN/A
4Cranberry-CNJ02-1-2017LG01N/A48.81trimcontig440230ViewN/A
5Cranberry-CNJ02-1-2007LG1N/A50.961trimcontig440230ViewN/A
6Cranberry-Crimson_Queen-2017LG01N/A43.91trimcontig440230ViewN/A
7Blueberry-W85-23-2017LG01N/A46.71trimcontig440230ViewN/A
8Cranberry-Crimson_Queen-2007LG1N/A46.11tc440230ViewN/A
9Cranberry-Mullica_Queen-2007LG1N/A54.41tc440230ViewN/A
10Cranberry-Composite_map-F1LG01N/A62.751trimcontig440230ViewN/A
11Cranberry-Crimson_Queen-F1LG01N/A35.751trimcontig440230ViewN/A
12Cranberry-Mullica_Queen_1-F1LG01N/A47.081trimcontig440230ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279249
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig440230.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig440230.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Total anthocyanin contentqTAC.CNJ02-1.LG01.3Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig4402301trimcontig440230Vaccinium macrocarponmarker_locus
1tc4402301tc440230Vaccinium macrocarponmarker_locus
1trimcontig4402301trimcontig440230-62.75Vaccinium macrocarponmarker_locus
1trimcontig4402301trimcontig440230-35.75Vaccinium macrocarponmarker_locus
1trimcontig4402301trimcontig440230-47.08Vaccinium macrocarponmarker_locus