2ms2g09, 2ms2g09 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	2ms2g09
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	2ms2g09.forward primer: GGGGAACTCAGATGGGTTTT
Primer 2	2ms2g09.reverse primer: GCTGTCATTTTTCGGAGAGC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:37026828..37027041 .
chr8	supercontig	chr8:473332..473532 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG4	N/A	0.8	2ms2g09	View
2	Cranberry-Composite_map-F1	LG08	N/A	1.78	2ms2g09b	View
3	Cranberry-Mullica_Queen_2-F1	LG08	N/A	0	2ms2g09b	View
4	Cranberry-Stevens-F1	LG08	N/A	0	2ms2g09b	View