1trimcontig440337, 1trimcontig440337 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name1trimcontig440337
Genbank IDKP279250
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)15
Primer 11trimcontig440337.forward primer: CTTGGAGTTAGCCTTTTAGTCA
Primer 21trimcontig440337.reverse primer: CTGGAAGAGTGAAGATGGAATA
Max Length182
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG08N/A71.71trimcontig440337View
2Cranberry-Crimson_Queen-F1LG08N/A01trimcontig440337View
3Cranberry-Mullica_Queen-2017LG08N/A99.81trimcontig440337View
4Cranberry-CNJ02-1-2017LG08N/A86.81trimcontig440337View
5Blueberry-F1#10-2017LG08N/A87.31trimcontig440337View
6Cranberry-CNJ02-1-2007LG8N/A91.231trimcontig440337View
7Blueberry-F1#10_x_W85-23-F1-2017LG08N/A87.41trimcontig440337View
8Cranberry-Crimson_Queen-2007LG8N/A77.41tc440337View
9Cranberry-Mullica_Queen-2007LG8N/A107.91tc440337View
10Cranberry-Mullica_Queen_1-F1LG08N/A1.791trimcontig440337View
11Cranberry-Composite_map-F1LG08N/A1.791trimcontig440337View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279250
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer1trimcontig440337.forward primerVaccinium macrocarponprimer
reverse primer1trimcontig440337.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
1trimcontig4403371trimcontig440337Vaccinium macrocarponmarker_locus
1tc4403371tc440337Vaccinium macrocarponmarker_locus
1trimcontig4403371trimcontig440337-1.79Vaccinium macrocarponmarker_locus