1trimcontig339726, 1trimcontig339726 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	1trimcontig339726
Genbank ID	KP279240
Type	EST-SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)17
Primer 1	1trimcontig339726.forward primer: TACTCATGTCGAAGCAATAGAG
Primer 2	1trimcontig339726.reverse primer: CTTTAGCAGAGGAGAAACAAGT
Max Length	199
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279240

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr06	supercontig	Vmac_chr06:1328964..1329133 .
chr6	supercontig	chr6:36541728..36541895 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG6	N/A	99.87	1trimcontig339726	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	85.6	1trimcontig339726	View
3	Blueberry-W85-23-2017	LG06	N/A	111.4	1trimcontig339726	View
4	Cranberry-CNJ02-1-2017	LG06	N/A	90.8	1trimcontig339726	View
5	Cranberry-Mullica_Queen-2017	LG06	N/A	102.4	1trimcontig339726	View
6	Cranberry-Mullica_Queen-2007	LG6	N/A	115.4	1tc339726	View
7	Cranberry-Composite_map-F1	LG06	N/A	2.19	1trimcontig339726	View
8	Cranberry-Mullica_Queen_1-F1	LG06	N/A	1.79	1trimcontig339726	View