214102_K63, 214102_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name214102_K63
Genbank IDKP279165
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)15
Primer 1214102_K63.forward primer: GGTAATAGCTTTGTGATCTTGC
Primer 2214102_K63.reverse primer: GATGGTGAATAAATTGCGAC
Max Length256
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG09N/A54.2214102_K63View
2Cranberry-Mullica_Queen-2007LG9N/A88.2214102_K63View
3Cranberry-Crimson_Queen-2007LG9N/A66.1214102_K63View
4Cranberry-CNJ02-1-2007LG9N/A73.09214102_K63View
5Cranberry-Mullica_Queen-2017LG09N/A77.6214102_K63View
6Cranberry-CNJ02-1-2017LG09N/A64.8214102_K63View
7Cranberry-Composite_map-F1LG09N/A21.73214102_K63View
8Cranberry-Crimson_Queen-F1LG09N/A16.16214102_K63View
9Cranberry-Mullica_Queen_1-F1LG09N/A24.49214102_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279165
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer214102_K63.forward primerVaccinium macrocarponprimer
reverse primer214102_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
214102_K63214102_K63Vaccinium macrocarponmarker_locus
214102_K63214102_K63-21.73Vaccinium macrocarponmarker_locus
214102_K63214102_K63-16.16Vaccinium macrocarponmarker_locus
214102_K63214102_K63-24.49Vaccinium macrocarponmarker_locus