308539_K70, 308539_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name308539_K70
Genbank IDKP279209
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)14
Primer 1308539_K70.forward primer: CTAAATTCTCAACATCTCTGGC
Primer 2308539_K70.reverse primer: CCAAGAAGCATAAGGGATAGT
Max Length313
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG11N/A54.52308539_K70View
2Cranberry-Mullica_Queen-2017LG11N/A60.1308539_K70View
3Cranberry-Crimson_Queen-2017LG11N/A46.9308539_K70View
4Cranberry-CNJ02-1-2017LG11N/A54.1308539_K70View
5Cranberry-Crimson_Queen-2007LG11N/A49308539_K70View
6Cranberry-Mullica_Queen-2007LG11N/A61.3308539_K70View
7Cranberry-Composite_map-F1LG11N/A54.19308539_K70View
8Cranberry-Crimson_Queen-F1LG11N/A47.83308539_K70View
9Cranberry-Mullica_Queen_1-F1LG11N/A63.36308539_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279209
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer308539_K70.forward primerVaccinium macrocarponprimer
reverse primer308539_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
308539_K70308539_K70Vaccinium macrocarponmarker_locus
308539_K70308539_K70-54.19Vaccinium macrocarponmarker_locus
308539_K70308539_K70-47.83Vaccinium macrocarponmarker_locus
308539_K70308539_K70-63.36Vaccinium macrocarponmarker_locus