308812_K70, 308812_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name308812_K70
Genbank IDKP279210
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)15
Primer 1308812_K70.forward primer: GAAAGGAAGGTATGCTACAGTT
Primer 2308812_K70.reverse primer: TCTTAGGAAAGACGAGAACATC
Max Length344
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG5N/A69.8308812_K70ViewN/A
2Cranberry-Crimson_Queen-2017LG05N/A65.4308812_K70ViewN/A
3Cranberry-CNJ02-1-2007LG5N/A74.69308812_K70ViewN/A
4Cranberry-Mullica_Queen-2007LG5N/A81308812_K70ViewN/A
5Cranberry-CNJ02-1-2017LG05N/A67308812_K70ViewN/A
6Cranberry-Mullica_Queen-2017LG05N/A69.3308812_K70ViewN/A
7Cranberry-Composite_map-F1LG05N/A63.17308812_K70ViewN/A
8Cranberry-Crimson_Queen-F1LG05N/A65.66308812_K70ViewN/A
9Cranberry-Mullica_Queen_1-F1LG05N/A73.38308812_K70ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279210
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer308812_K70.forward primerVaccinium macrocarponprimer
reverse primer308812_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
308812_K70308812_K70Vaccinium macrocarponmarker_locus
308812_K70308812_K70-63.17Vaccinium macrocarponmarker_locus
308812_K70308812_K70-65.66Vaccinium macrocarponmarker_locus
308812_K70308812_K70-73.38Vaccinium macrocarponmarker_locus