1trimcontig354570, 1trimcontig354570 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	1trimcontig354570
Genbank ID	KP279284
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TG)14
Primer 1	1trimcontig354570.forward primer: ACCTGTTCTGTTGATTACGAGT
Primer 2	1trimcontig354570.reverse primer: ACAGTATCGCACAATGAGTTC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279284

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr02	supercontig	Vmac_chr02:20414756..20415021 .
chr2	supercontig	chr2:19961326..19961583 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.