252600_K70, 252600_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name252600_K70
Genbank IDKP279205
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)14
Primer 1252600_K70.forward primer: CTAGTTTAGAGTCGTCCCAAAT
Primer 2252600_K70.reverse primer: AAGCACCTGAAGATAGTAGGAA
Max Length212
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG1N/A49.04252600_K70ViewN/A
2Cranberry-Mullica_Queen-2017LG01N/A53.4252600_K70ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A48.2252600_K70ViewN/A
4Cranberry-Mullica_Queen-2007LG1N/A55.6252600_K70ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279205
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer252600_K70.forward primerVaccinium macrocarponprimer
reverse primer252600_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
252600_K70252600_K70Vaccinium macrocarponmarker_locus