3ms2g09, 3ms2g09 (genetic_marker) Vaccinium corymbosum

Marker Overview
Name3ms2g09
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 13ms2g09.forward primer: CCTAAATTGCAGCCACTGGT
Primer 23ms2g09.reverse primer: ACGGCAAGACAACGTTCATT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG3N/A33.23ms2g09View
2Cranberry-Composite_map-F1LG05N/A37.053ms2g09View
3Cranberry-Mullica_Queen_2-F1LG05N/A24.083ms2g09View
4Cranberry-BB/CQ-F1LG03N/A68.633ms2g09View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer3ms2g09.forward primerVaccinium corymbosumprimer
reverse primer3ms2g09.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3ms2g093ms2g09Vaccinium corymbosummarker_locus
3ms2g093ms2g09-37.05Vaccinium corymbosummarker_locus
3ms2g093ms2g09-24.08Vaccinium corymbosummarker_locus
3ms2g093ms2g09-68.627Vaccinium corymbosummarker_locus