407841_K63, 407841_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name407841_K63
Genbank IDKP279175
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)17
Primer 1407841_K63.forward primer: TTGAGTAGATACATGCTGGCT
Primer 2407841_K63.reverse primer: CTCACCCTTTCTCTTGTGATA
Max Length294
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A1.8407841_K63View
2Cranberry-CNJ02-1-2007LG9N/A9.17407841_K63View
3Cranberry-Crimson_Queen-2017LG09N/A4.6407841_K63View
4Cranberry-Mullica_Queen-2007LG9N/A8407841_K63View
5Cranberry-CNJ02-1-2017LG09N/A3.3407841_K63View
6Blueberry-F1#10_x_W85-23-F1-2017LG09N/A2.7407841_K63View
7Blueberry-F1#10-2017LG09N/A4.8407841_K63View
8Blueberry-W85-23-2017LG09N/A0407841_K63View
9Cranberry-Crimson_Queen-2007LG9N/A10.3407841_K63View
10Cranberry-Composite_map-F1LG09N/A87.09407841_K63View
11Cranberry-Crimson_Queen-F1LG09N/A66.19407841_K63View
12Cranberry-Mullica_Queen_1-F1LG09N/A100.16407841_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279175
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer407841_K63.forward primerVaccinium macrocarponprimer
reverse primer407841_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
407841_K63407841_K63Vaccinium macrocarponmarker_locus
407841_K63407841_K63-87.09Vaccinium macrocarponmarker_locus
407841_K63407841_K63-66.19Vaccinium macrocarponmarker_locus
407841_K63407841_K63-100.16Vaccinium macrocarponmarker_locus