417854_K63, 417854_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name417854_K63
Genbank IDKP279188
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)17
Primer 1417854_K63.forward primer: AAAAGGAGTCTTGGGAGTAAGT
Primer 2417854_K63.reverse primer: TTGAGATGTAACTATGCAGTCC
Max Length297
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG2N/A96.98417854_K63View
2Cranberry-Mullica_Queen-2007LG2N/A108.4417854_K63View
3Cranberry-Crimson_Queen-2017LG02N/A79.2417854_K63View
4Cranberry-Mullica_Queen-2017LG02N/A100.4417854_K63View
5Cranberry-Crimson_Queen-2007LG2N/A88.4417854_K63View
6Cranberry-CNJ02-1-2017LG02N/A89.8417854_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279188
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer417854_K63.forward primerVaccinium macrocarponprimer
reverse primer417854_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
417854_K63417854_K63Vaccinium macrocarponmarker_locus