413893_K63, 413893_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name413893_K63
Genbank IDKP279264
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)21
Primer 1413893_K63.forward primer: TACTCCATTTCACAACACGA
Primer 2413893_K63.reverse primer: ATCTCTGCTTCTTCTACCTCTG
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279264
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer413893_K63.forward primerVaccinium macrocarponprimer
reverse primer413893_K63.reverse primerVaccinium macrocarponprimer