413893_K63, 413893_K63 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	413893_K63
Genbank ID	KP279264
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)21
Primer 1	413893_K63.forward primer: TACTCCATTTCACAACACGA
Primer 2	413893_K63.reverse primer: ATCTCTGCTTCTTCTACCTCTG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279264

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Chr03	supercontig	Chr03:208640..208879 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.