414791_K63, 414791_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name414791_K63
Genbank IDKP279183
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)17
Primer 1414791_K63.forward primer: ACGACTAGCAGCATTCAGTAA
Primer 2414791_K63.reverse primer: CAGGAGATCAGAAAACACAATC
Max Length362
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10_x_W85-23-F1-2017LG01N/A69.8414791_K63View
2Cranberry-Mullica_Queen-2017LG01N/A107.4414791_K63View
3Cranberry-Crimson_Queen-2017LG01N/A90.4414791_K63View
4Cranberry-CNJ02-1-2007LG1N/A105.85414791_K63View
5Cranberry-Crimson_Queen-2007LG1N/A93.3414791_K63View
6Blueberry-F1#10-2017LG01N/A98.3414791_K63View
7Cranberry-CNJ02-1-2017LG01N/A98.1414791_K63View
8Cranberry-Mullica_Queen-2007LG1N/A116.1414791_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279183
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer414791_K63.forward primerVaccinium macrocarponprimer
reverse primer414791_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
414791_K63414791_K63Vaccinium macrocarponmarker_locus