416275_K63, 416275_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name416275_K63
Genbank IDKP279184
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)15
Primer 1416275_K63.forward primer: GGTTATGATGGTGGGAAAG
Primer 2416275_K63.reverse primer: TGCACCTCCTCTCTCTCTAA
Max Length197
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279184
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer416275_K63.forward primerVaccinium macrocarponprimer
reverse primer416275_K63.reverse primerVaccinium macrocarponprimer