416328_K63, 416328_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name416328_K63
Genbank IDKP279185
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)21
Primer 1416328_K63.forward primer: GTATGCCCAGAATATCCATTAC
Primer 2416328_K63.reverse primer: TAGTCACGAGGAAAGCTAAAGT
Max Length225
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG4N/A33.6416328_K63View
2Cranberry-CNJ02-1-2007LG4N/A29.45416328_K63View
3Cranberry-CNJ02-1-2017LG04N/A32.7416328_K63View
4Cranberry-Crimson_Queen-2007LG4N/A25.1416328_K63View
5Cranberry-Mullica_Queen-2017LG04N/A34.4416328_K63View
6Cranberry-Crimson_Queen-2017LG04N/A0416328_K63View
7Cranberry-Composite_map-F1LG04N/A15.6416328_K63View
8Cranberry-Crimson_Queen-F1LG04N/A21.42416328_K63View
9Cranberry-Mullica_Queen_1-F1LG04N/A36.41416328_K63View
10Cranberry-Mullica_Queen_2-F1LG04N/A15.01416328_K63View
11Cranberry-Stevens-F1LG04N/A8.97416328_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279185
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer416328_K63.forward primerVaccinium macrocarponprimer
reverse primer416328_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
416328_K63416328_K63Vaccinium macrocarponmarker_locus
416328_K63416328_K63-15.6Vaccinium macrocarponmarker_locus
416328_K63416328_K63-21.42Vaccinium macrocarponmarker_locus
416328_K63416328_K63-36.41Vaccinium macrocarponmarker_locus
416328_K63416328_K63-15.01Vaccinium macrocarponmarker_locus
416328_K63416328_K63-8.97Vaccinium macrocarponmarker_locus