76326_K70, 76326_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name76326_K70
Genbank IDKP279197
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 176326_K70.forward primer: AATGTCTTCCAAATCAGGTG
Primer 276326_K70.reverse primer: CAAGAACGAACCCTCTATTTC
Max Length294
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG7N/A46.976326_K70View
2Cranberry-Crimson_Queen-2017LG07N/A42.276326_K70View
3Cranberry-Mullica_Queen-2017LG07N/A43.276326_K70View
4Cranberry-Mullica_Queen-2007LG7N/A49.876326_K70View
5Blueberry-F1#10_x_W85-23-F1-2017LG07N/A4676326_K70View
6Cranberry-Crimson_Queen-2007LG7N/A43.976326_K70View
7Blueberry-W85-23-2017LG07N/A43.276326_K70View
8Blueberry-F1#10-2017LG07N/A44.276326_K70View
9Cranberry-CNJ02-1-2017LG07N/A42.176326_K70View
10Cranberry-Composite_map-F1LG07N/A49.5876326_K70View
11Cranberry-Crimson_Queen-F1LG07N/A47.0776326_K70View
12Cranberry-Mullica_Queen_1-F1LG07N/A57.8676326_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279197
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer76326_K70.forward primerVaccinium macrocarponprimer
reverse primer76326_K70.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
76326_K7076326_K70Vaccinium macrocarponmarker_locus
76326_K7076326_K70-49.58Vaccinium macrocarponmarker_locus
76326_K7076326_K70-47.07Vaccinium macrocarponmarker_locus
76326_K7076326_K70-57.86Vaccinium macrocarponmarker_locus