418138_K63, 418138_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418138_K63
Genbank IDKP279265
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)16
Primer 1418138_K63.forward primer: CCTCTTCTTCATATCATCCAGT
Primer 2418138_K63.reverse primer: TTTAGCCCACTTTTATGCAC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10_x_W85-23-F1-2017LG05N/A64.5418138_K63View
2Blueberry-F1#10-2017LG05N/A69.5418138_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279265
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418138_K63.forward primerVaccinium macrocarponprimer
reverse primer418138_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
418138_K63418138_K63Vaccinium macrocarponmarker_locus