82171_K70, 82171_K70 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name82171_K70
Genbank IDKP279199
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)14
Primer 182171_K70.forward primer: TAGTAGAGTTGAAGAGGAGGGA
Primer 282171_K70.reverse primer: CTAGGGTTTAAGCAAGCATAGT
Max Length185
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG03N/A51.782171_K70View
2Cranberry-CNJ02-1-2007LG3N/A64.0382171_K70View
3Cranberry-Mullica_Queen-2007LG3N/A74.182171_K70View
4Cranberry-Mullica_Queen-2017LG03N/A64.182171_K70View
5Cranberry-Crimson_Queen-2007LG3N/A56.582171_K70View
6Cranberry-CNJ02-1-2017LG03N/A57.882171_K70View
7Cranberry-Composite_map-F1LG03N/A33.3682171_K70View
8Cranberry-Crimson_Queen-F1LG03N/A34.7882171_K70View
9Cranberry-Mullica_Queen_1-F1LG03N/A43.5782171_K70View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279199
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer82171_K70.forward primerVaccinium macrocarponprimer
reverse primer82171_K70.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Titratable acidityqTA.CNJ02-1.LG03Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
82171_K7082171_K70Vaccinium macrocarponmarker_locus
82171_K7082171_K70-33.36Vaccinium macrocarponmarker_locus
82171_K7082171_K70-34.78Vaccinium macrocarponmarker_locus
82171_K7082171_K70-43.57Vaccinium macrocarponmarker_locus