417587_K63, 417587_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name417587_K63
Genbank IDKP279187
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)19
Primer 1417587_K63.forward primer: TGGGTAGATATTAGATGGCAGT
Primer 2417587_K63.reverse primer: CTTCTTCTGGAAATCTGGTTAG
Max Length275
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG12N/A67.8417587_K63View
2Cranberry-Crimson_Queen-2017LG12N/A59.1417587_K63View
3Cranberry-CNJ02-1-2017LG12N/A67.4417587_K63View
4Cranberry-CNJ02-1-2007LG12N/A77.25417587_K63View
5Cranberry-Crimson_Queen-F1LG12N/A0417587_K63View
6Cranberry-Composite_map-F1LG12N/A5.82417587_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279187
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer417587_K63.forward primerVaccinium macrocarponprimer
reverse primer417587_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
417587_K63417587_K63Vaccinium macrocarponmarker_locus
417587_K63417587_K63-5.82Vaccinium macrocarponmarker_locus