418192_K63, 418192_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418192_K63
Genbank IDKP279266
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)18
Primer 1418192_K63.forward primer: CAGGCAGAAGAAGAAAGAAA
Primer 2418192_K63.reverse primer: TGAATTAAGAGAGGAGGAGAGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG08N/A39.74418192_K63View
2Cranberry-Stevens-F1LG08N/A25.46418192_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279266
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418192_K63.forward primerVaccinium macrocarponprimer
reverse primer418192_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
418192_K63418192_K63-39.74Vaccinium macrocarponmarker_locus
418192_K63418192_K63-25.46Vaccinium macrocarponmarker_locus