ct118602, ct118602 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect118602
Genbank IDKP279113
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1ct118602.forward primer: TAGAATGCAGTCGTGAAGTGTA
Primer 2ct118602.reverse primer: ACTAAATGAGGGGTAGTACGTG
Max Length159
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG02N/A99.56ct118602View
2Cranberry-Crimson_Queen-2017LG02N/A0ct118602View
3Cranberry-CNJ02-1-2017LG02N/A1.3ct118602View
4Cranberry-Crimson_Queen-F1LG02N/A98.96ct118602View
5Cranberry-BB/CQ-F1LG08N/A0ct118602View
6Cranberry-Mullica_Queen_1-F1LG02N/A112.64ct118602View
7Cranberry-Mullica_Queen-2017LG02N/A0ct118602View
8Cranberry-Mullica_Queen-2007LG2N/A0ct118602View
9Cranberry-Crimson_Queen-2007LG2N/A0ct118602View
10Cranberry-CNJ02-1-2007LG2N/A0ct118602View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279113
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct118602.forward primerVaccinium macrocarponprimer
reverse primerct118602.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct118602ct118602Vaccinium macrocarponmarker_locus
ct118602ct118602-99.56Vaccinium macrocarponmarker_locus
ct118602ct118602-98.96Vaccinium macrocarponmarker_locus
ct118602ct118602-112.64Vaccinium macrocarponmarker_locus