418294_K63, 418294_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418294_K63
Genbank IDKP279189
TypeEST-SSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)18
Primer 1418294_K63.forward primer: CAAGAACAAGAAGAAGAAGACC
Primer 2418294_K63.reverse primer: AGAGACCACCCAAAAGATAAG
Max Length348
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG04N/A0418294_K63View
2Cranberry-CNJ02-1-2007LG4N/A0418294_K63View
3Cranberry-Crimson_Queen-2007LG4N/A0418294_K63View
4Cranberry-Mullica_Queen-2007LG4N/A-1.3418294_K63View
5Cranberry-Crimson_Queen-F1LG04N/A0418294_K63View
6Cranberry-Mullica_Queen_1-F1LG04N/A0418294_K63View
7Cranberry-CNJ02-1-2017LG04N/A0418294_K63View
8Cranberry-Mullica_Queen-2017LG04N/A0418294_K63View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279189
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418294_K63.forward primerVaccinium macrocarponprimer
reverse primer418294_K63.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
418294_K63418294_K63Vaccinium macrocarponmarker_locus