CA187F, CA187F (genetic_marker) Vaccinium corymbosum

Marker Overview
NameCA187F
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1CA187F.forward primer: TGCAGAGAGAGTGCGAAAAA
Primer 2CA187F.reverse primer: TTTGCAGCTGATCTGGTTTG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Unifiedmap2013LG8N/A69.2CA187FView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerCA187F.forward primerVaccinium corymbosumprimer
reverse primerCA187F.reverse primerVaccinium corymbosumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit weightqFWT.Unifiedmap2013.LG8Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CA187FCA187FVaccinium corymbosummarker_locus