ct121951, ct121951 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect121951
Genbank IDKP279117
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTGGT)6
Primer 1ct121951.forward primer: CATGTAGCCGACTCCAATTA
Primer 2ct121951.reverse primer: TATCCCATTCCGTATAAGGTC
Max Length193
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG08N/A94.2ct121951View
2Cranberry-Mullica_Queen-2017LG08N/A107.6ct121951View
3Cranberry-Mullica_Queen_1-F1LG08N/A0ct121951View
4Cranberry-Mullica_Queen-2007LG8N/A115.7ct121951View
5Cranberry-Composite_map-F1LG08N/A0ct121951View
6Cranberry-CNJ02-1-2007LG8N/A98.75ct121951View
7Cranberry-BB/CQ-F1LG04N/A99.48ct121951View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279117
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct121951.forward primerVaccinium macrocarponprimer
reverse primerct121951.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct121951ct121951Vaccinium macrocarponmarker_locus
ct121951ct121951-99.477Vaccinium macrocarponmarker_locus