ct124256, ct124256 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namect124256
Genbank IDKP279118
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1ct124256.forward primer: GCCGTTAGTTCGTGATATGT
Primer 2ct124256.reverse primer: CCTACATGCATACGTAAAACAG
Max Length214
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG2N/A54.9ct124256View
2Cranberry-Mullica_Queen-2007LG2N/A65ct124256View
3Cranberry-CNJ02-1-2017LG02N/A58.3ct124256View
4Cranberry-Mullica_Queen-2017LG02N/A61.5ct124256View
5Cranberry-Crimson_Queen-2017LG02N/A53ct124256View
6Cranberry-CNJ02-1-2007LG2N/A58.83ct124256View
7Cranberry-Composite_map-F1LG02N/A43.3ct124256View
8Cranberry-Crimson_Queen-F1LG02N/A45.31ct124256View
9Cranberry-Mullica_Queen_1-F1LG02N/A53.24ct124256View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279118
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerct124256.forward primerVaccinium macrocarponprimer
reverse primerct124256.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
ct124256ct124256Vaccinium macrocarponmarker_locus
ct124256ct124256-43.3Vaccinium macrocarponmarker_locus
ct124256ct124256-45.31Vaccinium macrocarponmarker_locus
ct124256ct124256-53.24Vaccinium macrocarponmarker_locus