418730_K63, 418730_K63 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Name418730_K63
Genbank IDKP279267
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)17
Primer 1418730_K63.forward primer: ACAGATCCAGTCTCTTCAAATC
Primer 2418730_K63.reverse primer: ATACGGAGTGTAGATGTCTCCT
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP279267
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primer418730_K63.forward primerVaccinium macrocarponprimer
reverse primer418730_K63.reverse primerVaccinium macrocarponprimer